Well, I didn't do such a good job with the actual presentation but it was approved.

A word about this thesis proposal

The thesis proposal didn't format correctly and none of my graphs and charts made the transition to whatever Blogspot uses.

I will try to transfer some of them over as jpegs or excel documents.

The painting is an abstract representation of Dopamine at the post synaptic receptor.

If you discover a mistake or spelling/gramatic error, please tell me so I can make corrections.

Thesis Proposal

Determining the Simplest Structure Capable of Antagonizing Cocaine’s Activity in Planarians and the Consequential Change in the Expression of Dopaminergic Membrane Proteins













Table of Contents


Background Information……………………………………………………………5
Introduction …………………………………………………………………………. ….. 6
Information about Planarians ……………………………………………………………..6
Dopamine ………………………………………………………………………………...7
Cocaine’s Effect on the CNS ……………………………………………………………..8
Information about Cocaine ……………………………………………………………….9
Cocaine as a Local Anesthetic …………………………………………………..10
The Evolution of the CNS……………………………………………………………….13
Planarians as a Model Organism…………………………………………………………17
Previous Research using Planarians ……………………………………………………..19
The Use of DMSO as a Solvent………………………………………………… 20
Testing Sesquiterpenes ………………………………………………………………….21

Part One …………………………………………………………………………………………23
Proposed Investigation …………………………………………………………………..24
Methods and Materials………………………………………………………………….. 25
General Procedure ………………………………………………………………………26
Surface Area to Volume Ratio ………………………………………………………….30
Results……………………………………………………………………………………31
The Effect of γ-Lactones on Planarian Motility…………………………………31
Discussion ………………………………………………………………………………34
Similar Results in Mammals……………………………………………………………. 36
Part Two …………………………………………………………………………………………37
Introduction …….………………………………………………………………………. 38
Methods ………………………………………………………………………………….39
Procedure………………………………………………………………………………...40
Analysis of Results………………………………………………………………………42
Expected Outcomes ……………………………………………………………………..44
Alternative Approaches …………………………………………………………………47
Part Three ……………………………………………………………………………………… 48
Introduction ……………………………………………………………………………...49
Methods and Materials …………………………………………………………………..49
Substances Tested ……………………………………………………………………….50
Expected Outcomes/Alternative Approaches ………………………………………….. 51
Room for Improvement …………………………………………………………………52
Bibliography ………………………………………………………….…………………………53
Appendix…………………………………………………………………………………………58

















Background Information









Introduction

Planarian worms are being used as model organisms in research related to the Central Nervous System because they occupy a unique niche in the evolution of the central nervous system. They are believed to be the extant species that is the closest, morphologically, to the common ancestor shared by all subsequent species that posses a centralized nervous system. The planarian nervous system is relatively simple but, paradoxically, it possesses the same neurological elements that are found in more evolved species. Genes of the central nervous system are very highly conserved, consequentially, there is reason to believe results obtained by observing planarians will contribute to a better understanding of similar processes in mammalian species including humans. Because planarian genome has been mapped and resulting data are being made available, observing and analyzing behavior in planaria has become a relevant resource for investigation.

Planaria is the common name for several genera of free-living non-parasitic flatworms. Taxonomically, planarians belong to the phylum Platyhelminthes, class Turbellaria, order Tricladida (Carranza, et al. 1998). Planarians make up various family, genera, and species. Although they possess three germ layers, planarians are acoelomates.
Planarian Biologists in Asian labs tend to work with Dugesia japonica. As its name implies, it is a common species of planaria in Japan. Dugesia tigrina is the most common species in the United States but it is the genome of Schmidtea mediterranea has been mapped by Dr. Alejandro Sánchez Alvarado and his colleagues at the University of Utah. The accomplishment of the Sanchez lab opens up access to genetic assays that will enable Biologists to determine transcription and expressing rate while siRNA will be used to silence genes to determine function (Gentile, et al., 2011; Sofia, 2007). . It is not unreasonable to predict S. mediterranea will replace both D. tigrina and D. japonica in the next five years (Gentile, et al., 2011).


Information about Dopamine
Dopamine is a neurotransmitter that can be found in the brain of planarians. It is synthesized from the amino acid Tyrosine. It is stored in vesicles in the end of an axon. With the appropriate stimulation, dopamine is secreted into the synaptic cleft. Dopamine travels across the synaptic cleft to the receptor on the neuron on the other side of the cleft.
There are two major types of dopamine receptors and planarians have both types. They are D1 (including D1 like) and D2 (including D2 like.) The major difference between these two receptors is that, upon stimulation, D1 receptors are coupled with the G-protein that stimulates the release of adenylate cyclase (cAMP.) Conversely, when D2 receptors are stimulated, the activity level of cAMP decreases or is unaffected (Venturini, et al., 1989).
The dopamine transporter (DAT) is a transmembrane protein that pumps dopamine out of the synapse and into the neuron from which it originated (Venturin, et al., 1989). Dopamine is repackaged into vesicles to be used again.
Cocaine is an addictive drug as a result of the way that it exploits the dopaminergic neural pathways, experienced as a sense of euphoria in human subjects. Dopamine is prevented from being cleared from the synapse when cocaine acts as a competitive reuptake inhibitor. Eventually, more cocaine is needed for the addict to experience the same intensity of euphoria. Recently, knockout mice without dopamine transporters have demonstrated addictive “seeking” behaviors which led to the discovery that cocaine affected serotonin transporters as well as dopamine transporters (Ribeiro, et al., 2005; Iversen, 2009; and NIH.1998).
Because dopamine and serotonin are both associated with motivation, pleasure, and reward, cocaine is an extremely addictive substance. The dopaminergic system is actually altered in chronic addicts (Volkow, et al., 1993). Because cocaine blocks the dopamine transporter, and excessive dopamine accumulates in the synapse, the number of postsynaptic receptors is actually decreased in long-term addicts (NIH, 1998).
Additionally, some physiological effects of cocaine exposure include tachycardia, elevated body temperature, decreased appetite, and an increase in energy; the result of cocaine’s effect on epinephrine. (Koehntop, et al., 1977).



Information about cocaine
Cocaine is a derivative of the coca plant, Erythroxylum coca, which thrives in its woodland environment of South America. Indigenous peoples of that region have taken advantage of its medicinal properties and have also incorporated into their religious rituals. Generally, indigenous people struck a balance with their natural environment and used the coca leaves with respect and moderation (Personal conversation with Sue Mustalisch, Professor of Health Science at West Chester University).
According to anthropologists, natives of Peru were aware of the anesthetic properties of the coca plant. They would chew the leaves and drool on the part of the body that needed to be cut. Cocaine was applied to the wounds associated with trepanning procedures that were performed into the early part of the twentieth century (Musto, 1991).
There are some accounts of the indigenous use of white powder and herbs that would increase energy and take away painful sensation. These accounts were documented by the priests and scribes that accompanied the Spanish in the fifteenth and sixteenth century (Calatayud, and Gonzalez 2005).
Cocaine was initially transported to Europe and studied by Friedrich Gaedcke. Starting in 1855, he extracted an, “amorphous substance,” from the coca plant and identified it as an alkaloid naming it Erythroxyline. In 1860, another chemist, Dr. Carl Sherzer, transported cocaine to Europe and, along with his colleague, Albert Niemann, extracted cocaine from Erythoxyline. Niemann was the first European known to observe the anesthetic effect of cocaine when it numbed his tongue (Koller, 1941).
In 1868, Thomas Morenoy Maiz, a surgeon in the Peruvian army, wrote a book based on records he kept while experimenting on animals in his care (Moreno y Maiz, T., 1868). In 1879, Vassili von Anrep noticed that applying cocaine in solution would numb the skin on the exposed region. He also dropped the same solution onto the eye of an animal which would numb the eyeball and dilate the pupil (Vandam, 1987). For some reason, it took another five years before cocaine was recognized as a local anesthetic.
Cocaine was the first clinically used local anesthetic (Sholz, 2002). Albert Niemann isolated cocaine from the coca leaves (Koller, 1941) and Sigmund Freud was the first one to treat a patient with it. Ironically, Freud used cocaine to wean his patients from morphine. He and colleague, Karl Koller, were also the first to demonstrate its numbing effect when applied occularly. Although Koller cited Anrep’s previous work that was published, Koller was credited with the discovery because his work that confirmed Anrep’s original findings were published in a professional journal that was prominent to the surgeons of his era (Yentis and Vlassakov, 1999) Dr. William Stewart Halsted is credited to be the first to describe the effect when cocaine is injected into the sensory nerve trunk (Osborne, 2007). Unfortunately, no one knew about the addictive qualities of cocaine and Freud, as well as many other prominent people of the late Victorian era, became cocaine addicts before laws could be passed to regulate the substance (Koller, 1941).
The mechanism of action that interferes with the transmission of sensation is a disturbance in the resting potential in the sodium gated ion channels. Most theories involve open/closed, active/inactive channels. Other theories propose a disturbance in the phospholipid bilayer of the cell membrane. Local anesthetics are generally divided into amides and esters (Vandam, 1987).
Amylocaine was the first synthetic local anesthetic. It was synthesized in 1903 and was quickly overshadowed by the formulation of procaine in 1904. Both Amylocaine and Procaine (Novacaine) are esters and analogs of cocaine (McLure and Rubin, 2005). The slight change in molecular conformation was sufficient to keep the structure effective as a local anesthetic but lost its addictive quality. Soon after Procaine was first synthesized in 1904, it became widely available in dental offices and emergency rooms. During the second half of the twentieth century, Amides took the place of esters and local anesthetics took effect more rapidly and had a lower incidence of allergic reactions (Calatayud and Gonzalez, 2005).

From the plant’s perspective, cocaine evolved as a potent weapon in E.coca’s botanical arsenal. Cocaine affords effective protection against predation. It is worth mentioning the likelihood that many potential future pharmaceuticals may be found in the arsenal of hundreds of thousands of known and yet-to-be discovered plants, animals, and microscopic life forms that are players in the evolutionary arms race that share habitat with Erythroxylum coca (Perfecto and Vandermeer, 2008). The cocaine molecule has four chiral centers which allow it to form 16 isomers (McLure and Rubin, 2005).
Parthenolide, a Sesquiterpene lactone, has been established to antagonize behavior that is associated with cocaine in planarians. Parthenolide is a relatively complex ringed structure. Because of this, determining the simplest structure that has the capacity to antagonize cocaine in planarians has the potential to contribute to a better understanding of the mechanisms that work to antagonize the behavioral effects cocaine has on planarians. Recent findings have identified γ-Nonalactone as the simplest structure needed to effectively antagonize cocaine toxicity in planarians (Baker, et al., Accepted for publication and available online). Established procedures will be used to determine the genetic and biochemical properties that cause these lactones to be effective cocaine antagonists in planarians. (Raffa, et al., 2005).
Determining any changes in the transcription rate of key components in the cocaine-sensitive dopaminergic pathway will contribute to a more comprehensive understanding of the mechanism of action that lactones employ as cocaine antagonists.

Gamma Lactones were not selected randomly for examination. When several compounds were introduced to the aqueous environment in which planarians were contained, the compounds with the five-carbon lactone ring structure were found to alleviate the withdrawal symptoms in planarians with Parthenolide demonstrating the greatest effect (Pagán, et al., 2008). Parthenolide is similar in many ways to compounds such as β-eudesmol, which shares similarities in molecular structure that had no significant effect on planarians that were exposed to cocaine. The structures that were active often had the lactone structure (a“lactone” is a ringed ester.) These ringed structures can also be found in traditional herbal medicines that have been used by people for thousands of years. Feverfew (Tanacetum parthenium) is a good example. Parthenolide is one of the identified molecules in this herbal remedy (Erlich, 2008).



The Evolution of the CNS

Development of bilateral symmetry and cephalization were important precursors to the evolution of the Central Nervous System (CNS). Bilaterians most likely descended from a common flatworm-like ancestor during the Cambrian geological period approximately 550-600 million years ago (Jacobs, et al., 2005).
Until a few years ago, the dominant theory was that vertebrates, insects, and flatworms diverged from a common bilaterians ancestor, appropriately named Urbilateria, and went on to evolve giving rise to three distinct nervous systems; the ganglion and ladder-like nerve cord of planarians, the segmented ganglia of arthropods, and the brain and spinal cord and inverted dorsoventral axis of vertebrate systems, (Sarnat and Netsky, 1985). New evidence suggests the Urbilateria had not only developed bilateralism but also acquired the genes that form the foundation of a CNS (Jacobs, et al. 2005). All organisms with a defined CNS have origins in this common ancestor. This is reflected in the evidence that many associated genes are extremely highly conserved across all species that possess a CNS (Mineta, et al., 2003). Although significant differences exist in the morphology of individual species, each possesses corresponding regions that, even when their neurological systems are morphologically dissimilar, posses, “similar molecular fingerprints,” that reflects a high degree of conservation (Sarnat and Netsky, 2002).

Planarians possess a CNS with simple primitive morphology. The, “brain,” is a centralized U-shaped ganglion with ventral nerve cords. The ganglion has nine branches that form pairs of connections to symmetrical sensory organs. The cephalic ganglion is similar to more complex vertebrate CNS. Some examples of features both share include multipolarized neurons and homologs of the otx (orthodenticle) genes that are expressed in the anterior region of the planarian cephalic ganglion (Ribiero, 2005). The planarian ganglion is, indeed, considered a primitive brain. The simple representation in Figure 5 shows bilateralism with the yellow regions being devoted to mechano-sensory activities, the green are chemosensory, blue represents light-sensory, and red represents inter-neuron activity (Agata, 1998). Planarians also possess a peripheral nervous system that is distinct from the central nervous system. The planarian cephalic ganglion exhibits many morphological features similar to the vertebrate CNS, such as multipolarized neurons.
Taxonomically, planarians belong to the phylum Platyhelminthes. The taxonomic niches are being adapted by molecular analyses of the 18s rRNA sequences and, using this measure, bilateral animals are being classified into three groups: Deuterostomia, Ecdysozoa, and Lophotrochozoa (Huson and Scornavacca, 2011). Platyhelminthes are found near the root of Lophotrochozoa.
Because planarians are so close to the morphology of the early bilateral ancestor and because planarians occupy a unique place wherein they possess qualities shared by vertebrates, they are an ideal species to use in the study of the evolution of the CNS (Agata, et al., 1998)


Key Genes for the CNS and Their Conservation Across Species

Figure 6: Source K. Agata
Figure 6: Key Genes for the CNS
When key genes in the central nervous system were compared across species, 110 of 116 head genes found in planarians were shared by all of the bilateral animals that have been examined (C. elegans, D. melanogaster, and H. sapiens.) The absent genes , the 6 out of 116 genes that were analyzed, were absent in C. elegans and/or in D. melanogaster. These three species belong to the three different groups of bilaterians that have a CNS (Agata, et al., 1998). These genes include FGF signaling molecules, noggin, and frizzled, among many others. Because so many functional genes are so highly conserved, one leading theory suggests that all bilaterians with a CNS share a common ancestor (Sarnat and Netsky, 1985).



Figure 7: Bilateral Symmetry in Planarians

Because the CNS seems to be so highly conserved and because planarians appear to be the closest extant organism to a shared common ancestor, several research laboratories have been busy observing and documenting normal behavioral patterns in planarians that have been exposed to various chemicals that act upon various neurotransmission pathways. Responses to compounds such as cocaine (Raffa, et al., 2003), caffeine (Pagan, et al., 2009), nicotine, (Pagan, et al., 2009), aspartame (unpublished data, Baker, 2010), and NMDA (Rawls, et al., 2007), have been observed in planarians. These observations have established a variety of behaviors that are considered normal which has, in turn, made it possible to identify behavior that departs from the standard (Raffa, et al., 2001).
With respect to cocaine, planarians exhibit predictable behavior patterns upon exposure to cocaine at sufficient concentrations. Their movement is retarded significantly. They also go through seizure-like movements during which they frequently curl up into a, “C-like position.” This is a spasm-like behavior that is distinguishable from the more smooth movements that are within the planarians repertoire. Another behavior that is associated with cocaine toxicity is the, “head bop,” in which they appear to have the tail pinned to the bottom of the dish while they waggle back and forth (Raffa, et al., 2001; Pagán, et al., 2008).


Planarians as a Model Organism
By the turn of the twentieth century, Biologists were aware of the regenerative abilities of planarians. The earliest known reference was found in a Japanese encyclopedia dating to the seventeenth century (Sanchez, 2010). Over 600 scholarly papers about planarians were published around the turn of the twentieth century. Research varied from light-dark studies to regeneration after exposure to radiation.
The reason planarians stopped being used in advanced research was a direct result of the intellectual rivalry between two distinguished developmental and genetic biologists, namely Charles Manning Child and Thomas Hunt Morgan (Clark, 1992).
Thomas Hunt Morgan embraced Mendelian Inheritance theories and believed there was a distinction between somatic and germ line genetics. Since Drosophila melanogaster expresses its germ line earlier in development, D. melanogaster became a model organism for use in developmental and genetics research (Nobel Prize Biography).
Child used planarians in his research and was much more interested in environmental influences and phenotypes. Child was not quite convinced that genes were stored on chromosomes. He also rejected the notion that two discrete sets of molecular instructions exist; the somatic and germ line (Clark, A., 1992).
Child and Morgan chose to ignore one another’s existence and certainly did not acknowledge the other’s contribution to genetics and developmental biology.
Eventually, Morgan’s ideas were supported by subsequent discoveries and his work with D. melanogaster became associated with the emerging discipline while planarian research fell out of favor (Clark, 1992). Ironically, some trends have come full circle and the work Morgan pioneered in the field of genetics has resulted in the mapping of the human genome as well as the genomes of many other species. As a result, the focus of research has shifted to epigenetics; the study of how environment interacts with the basic instructions contained within the cell, and stem cell technology that holds the hope of innovative therapies. Because they have adult pluripotent stem cells distributed throughout their body, planarians are able to allow regeneration of an entire individual from a tiny fragment of tissue. As a consequence of their remarkable ability to regenerate and because of their status as the least evolved organism with a central nervous system, planarians are being rediscovered as model organisms in labs all around the world (Gentile, 2011).

Advancements in sequencing DNA have contributed to resurgence in planarian Biology. Dr. Alejandro Sánchez Alvarado was among the first to recognize the potential benefits of mapping the genome of at least one species of planarians. It was necessary for him to harvest planarians from a fountain in Spain. The genus and species of his planarians just happened to be, “Schmidtea mediterranea,” which is why this particular genus and species will most likely emerge as the model species for planarian research into regeneration (Newmark and Sánchez-Alvarado, 2003).
Planarians are emerging as model organisms in the areas of regeneration research, particularly using adult stem cells and in the area of neurological and neuropharmacological research (Gentile, et al., 2011). Along with its abilities to regenerate, planarians are able to reproduce sexually and asexually. S. mediterranea houses its genome on four stable diploid chromosomes (Lau, et al., 2007).






The Use of DMSO as a Solvent

Dimethyl Sulfoxide (DMSO) is a polar aprotic organic molecule. Because of these qualities, DMSO serves as an excellent solvent. Unfortunately, DMSO is also controversial since it has been associated with at least one human death and has been rumored to be teratogenic to the developing brain. The Material Safety Data Sheet does not consider DMSO to be teratogenic or dangerous unless the concentration was high (MSDS). A solvent was needed to put some substances that were being tested into solution and DMSO was an attractive option but it was found to be toxic in planarians at a high concentration. Tests have been conducted in order to determine the level of DMSO necessary for effectiveness but in a concentration that will not affect the behavioral responses in planarians. For normal, 1-2cm long planarians, this ideal concentration is about 0.1% (Pagán, et al., 2006).



Testing Sesquiterpenes

Various organic compounds have been tested to determine if any of them was able to antagonize cocaine’s effect in planarians. Eventually, a group of ringed organic Sesquiterpenes were suspected to be good candidates for investigation. After careful observation, a Sesquiterpene with the five sided gamma lactone, Parthenolide, was found to antagonize the symptoms of cocaine’s activity in planarians (Pagan, et al., 2008).
The idea of testing Parthenolide against cocaine in planarians originated in Dr. One Pagan’s dissertation. The following narrative is a direct quote taken from Dr. Pagan’s dissertation defense.
“Why parthenolide? The idea of using parthenolide as a cocaine-displacing ligand came from its close structural similarity to another class of natural products, the cembranolides. Cembranolides are cyclic diterpenoids widely distributed in nature. More than 300 examples have been described (Wahlberg & Eklund 1992).

The cembranolides are established ligands of the nicotinic acetylcholine receptor (nAChR). The nAChR is the best-known member of the ligand-gated ion channel superfamily. This receptor will not be discussed here, and the reader is referred elsewhere (Karlin, 2002). Cembranolides bind in a mutually-exclusive manner with the local anesthetic procaine, on the nAChR (Pagán, 1998; Pagán et al., 2001).
The “line of thought” that led me to consider parthenolide as a cocaine antagonist was:
1. Cembranolides and an example of a local anesthetic bind to nicotinic acetylcholine receptors (nAChRs) in a mutually-exclusive manner (Pagán, 1998, Pagán et al., 2001).
2. Cocaine is the prototype of the local anesthetic class of molecules, with neuronal sodium channels as the target (Ruetsch et al., 2001; Scholz, 2002). However, its behavioral effects are due to cocaine’s interaction with neurotransmitter transporters, mainly the dopamine transporter (Uhl et al., 2002).
3. Parthenolide shows close structural similarity with cembranolides.
4. Parthenolide interacts with nAChRs and is capable of alleviating cocaine inhibition of this receptor in electrophysiological studies (Pagán and Hess, unpublished results).
Based on the points above, I thought that parthenolide and cocaine had the potential to interact with the dopamine transporter” (Pagan, 2005).


Cocaine ester acts as an anesthetic as well as a dopamine reuptake antagonist (Koehntop, 1977). Cocaine amide acts as a local anesthetic but does not produce the behavioral effects that are associated with excessive dopamine levels (Iversen, 2009).

Figure 9; Parthenolide (left) and Euniolide (right) Shown together to illustrate structural similarity.















Part One
Determining Which Lactones Antagonize Cocaine











Proposed Investigation

Testing response in planarians when exposed to cocaine and various gamma lactone structures
Determining the simplest structure that antagonizes cocaine
qrtPCR assays to detect and quantify significant changes in transcription and/or expression rates for various genes in the dopaminergic pathways.
Testing other neuronally active compounds in order to establish anything found to antagonize cocaine does so with specificity.











Part One: Determining the simplest structure necessary to antagonize cocaine toxicity in planarians

Methods and Materials
Animals and chemicals: Brown planarian worms (Dugesia tigrina) were purchased from Ward’s (Rochester, NY). General laboratory materials and supplies were obtained from Fisher Scientific (Suwanee, GA) or Sigma-Aldrich (St. Louis, MO); (-) Cocaine hydrochloride was purchased from Sigma-Aldrich (St. Louis, Mo). The tested Alkyl gamma-lactones were purchased from Chromadex (Irvine, CA).

General Procedure

The first molecules to be examined were the five sided ringed structure known as gamma lactones. Gamma lactone structures were systematically tested starting with the simplest structure and progressing to sequentially longer hydrocarbon chains.
The simplest gamma lactone tested was gamma Valerolactone. C5H8O2. The lactone with the longest hydrocarbon chain was gamma Dodecalactone C12H22O2

Gamma Lactones that were Observed

Figure 10: Gamma Lactones Used in Study


The concentration of each lactone tested was determined by testing planarians in solution with decreasing concentration of lactones until the activity level of planarians in solution demonstrated no significant variation from the control.
For every trial, a set of controls was also conducted and the activity of the planarians subjected to various lactones with or without cocaine was compared to their corresponding control.
Each planarian was tested once and euthanized with 0.2 M HCl.
The concentration of cocaine used was determined by conducting an observation of activity at decreasing concentrations. It was determined that large (>2cm) individuals needed higher concentrations of cocaine in order to exhibit typical cocaine-induced behavioral changes.
Planarian movement was tested by placing an individual planarian in a 6cm diameter petri dish with the specified solution containing the specified concentration added. The petri dish was pre-rinsed in APW (Artificial Pond Water composed of NaCl, CaCl2, NaHCl3 and Distilled H2O) and covered. Each individual was pre-incubated in solution for 10 minutes and the petri dish was set on a grid whose lines formed 1cm squares. When timing commenced, planarians were perturbed by swirling the solution in the dish. Notations were made when the planarians crossed the 1cm hash mark. Movement was documented every minute for a total of five minutes for every observation.

Gamma Lactones Used in this Observation
Lactone Concentration
γ-Valerolactone 203 µM
γ-Hexalactone 195 µM
γ-Heptalactone 100 µM
γ-Octalactone 100 µM
γ-Nonalactone 51 µM
γ-Decalactone 10 µM
γ-Dodecalactone 10 µM


Cocaine was tested at a concentration of 200 µm.
0.1% DMSO was included in all solutions including controls.
Data were analyzed using Prism Graph Pad software and the data were subjected to regression analysis using a two-tailed t-test.

Surface Area to Volume Ratio

The intensity of responses that planarians demonstrate upon exposure to cocaine is influenced by the surface area to volume ratio of the individual planarian. Motility in very small and very large individual planarians can be different from individuals that are within one standard deviation of the mean. This potential problem is resolved by selecting planarians by size. Planarians also need to be starved for at least one week in order to eliminate possible interactions with nutrients and/or metabolites associated with digestion. After testing responses in planarians that were either extremely small (<1cm) or extremely large (>2cm,) the small individuals responded more vigorously to something that elicited a neurological response and the large individuals generally needed a higher concentration to exhibit a response. This correlates to the surface area to volume ratio. Because of this phenomenon, planarians were selected for observation based upon their size. Individuals between 1 and 2 cm were selected for observation.

Figure 12: Difference in Motility Comparing Extremely Small and Extremely Lare Planarians

Results
The Effect of γ-Lactones on Planarian Motility
Figure 13 shows a series of concentration-response curves of planarian motility. Motility decreases as a function of γ-lactone concentration. The three smaller lactones (Valerolactone, Hexalactone, and Heptalactone) did not inhibit planarian motility at concentrations below 500 µM.
The larger lactone structures (Octalactone, Nonalactone, Decalactone and Dodecalactone) decreased planarian motility in a concentration-dependent manner. The least potent in the latter group of compounds was Octalactone which had an IC₅₀ of approximately 426 µM while the most active compound, Decalactone displays an IC₅₀ 43µM.


Motility as a Function of γ-Lactone Concentration

Figure 13: Motility as a Function of Concentration

Appendix Table 2 illustrates the results of parallel experiments using 200 μM cocaine in the absence and in the presence of a single γ-lactone concentration at which the lactone did not induce motility decrease by itself. Cocaine at a concentration of 200 μM decreased planarian motility by about 50 % (Figure 14), which is consistent with previously reported results (Pagán, et al., 2008).


The only compound capable of antagonizing cocaine effectively was γ-nonalactone, which, at a concentration of about 50μM, significantly alleviated the 200μM cocaine-induced motility decrease from about 51% (cocaine alone) to about 12% (cocaine + γ-nonalactone, ) See Appendix Table 2. Figure 14 demonstrates γ-nonalactone’s effect on cocaine-induced motility decrease as concentration-dependent and becomes synergistic with cocaine at γ-nonalactone concentrations higher than 75μM.


Results for γ-Nonalactone

Figure 14: Results for Gamma Nonalactone expressed at a fraction of the control.


Discussion
This work has established the γ-lactone moiety associated to a 5-carbon methyl tail attached to position 4 in the lactone ring (γ-nonalactone, Figure 15.) to be the minimum structure necessary to reverse cocaine-induced mobility inhibition in planarians. This is consistent with previous work which indicated that the lactone ring in this class of compounds is essential for their cocaine-antagonist effect in this experimental system (Pagán, et al., 2008). The results, however, indicate that the γ-lactone moiety is not sufficient to antagonize cocaine effects because none of the other lactones that were tested demonstrated any significant alleviation of cocaine-related symptoms in planarians. We also determined that the γ-nonalactone effect on cocaine was concentration-dependent, suggesting that γ-nonalactone and cocaine compete for a specific binding site in planarians, presumably a protein receptor. Additional evidence in favor of a common or overlapping binding site for cocaine and the γ-nonalactone can be deduced by the observation that γ-lactones with alkyl chains longer than 5 carbons decrease motility by themselves yet they are inactive antagonists against cocaine.
This phenomenon is somewhat reminiscent of the cutoff effect observed in some types of general anesthetic molecules. The cutoff effect is the increase in anesthetic potency of a homologous series of compounds, for example, n-alkanes or n-alkanols among others, up to a point where a decrease (or even total loss) of the anesthetic effect is observed in higher molecular weight compounds (Eckenhoff et al., 1999). This effect is frequently used to estimate the molecular dimensions of protein targets (Eckenhoff , et al., 1999; Franks and Lieb, 1985), but other interpretations, including the interaction of the anesthetic compounds with membranes, as opposed to proteins, has also been proposed (Mohr, 2005). It is possible that we are observing a mechanism similar to the cutoff effect in these γ-lactones/cocaine experiments.
Interestingly, the biggest lactone tested, Dodecalactone, is very similar to Parthenolide in terms of its molecular weight, yet Dodecalactone was inactive against cocaine. This indicates that molecular size must not be the only property that influences parthenolide's (or the γ-lactones) anti-cocaine properties.



Similar Results in Mammals

Parthenolide has recently been administered to rats that had been exposed to, “acute,” injections of cocaine. Parthenolide has been found to block the inhibitory effect of cocaine upon the dopamine neurological firing rate in the rats. In mammalian systems, cocaine works on the ventral tegmental area of the dopaminergic network which is associated with motivation and reward. These more sophisticated pathways do not exist in planarian systems but it is significant that Parthenolide seems to inhibit the activity of cocaine using a pathway in a mammalian subject that is not found in the planarian brain (Schwartz, et al., 2011).




Part Two: Determining how the Transcription Rate of Dopamine Receptors is Affected by Parthenolide and Gamma Nonalactone










Introduction

Our lab has recently submitted a paper for publication in which we have documented the alkyl γ -lactone structure with a four carbon hydrocarbon chain that is the least substituted structure necessary to antagonize the effect cocaine has on the nervous system of planarian worms. The mechanism of action is not known but cocaine is known to obstruct the dopamine transporter protein (Mateo, et al., 2004). It is also known to decrease the number of post-synaptic dopamine receptors in humans that abuse cocaine (Volkow, 1997). As a result, understanding the changes in transcription in RNA that is translated into the Dopamine transporter protein and associated membrane proteins may be illuminating.










Methods

Planarians of a uniform size will be separated into four discrete groups according to their treatment. The first group will be the control that will be exposed to artificially formulated pond water (APW) and Dimethyl Sulfoxide (DMSO) at 0.1%. Another group will be exposed to cocaine at a concentration of 200 µM. A third group will be exposed to a combination of cocaine at 200 µM and gamma nonalactone at a concentration of 50 µM. The fourth group will be a combination of cocaine at 200 µM and Parthenolide at 50 µM.
The planarians will be decapitated and their heads will be harvested and homogenized. mRNA will be isolated and the transcription rate for genes of interest will be evaluated. The results will be compared in such a way that any significant differences between the control and the other variable being tested will be analyzed.






The proposed procedure is as follows:
RNA isolation

Approximately ten planarians will be subjected to each of the four treatments for ten minutes after which they will be euthanized, decapitated, and placed in Trizol. They will be homogenized using a Power Gen 125 homogenizer.
0.5µL. of Trizol will be added in a microfuge tube and the mixture will be allowed to incubate for 5 minutes.
Chloroform (50µL) will be added and the mixture will be gently shaken for 15 seconds.
It will be incubated and then centrifuged for 10 minutes at 12,000 (rpm/ref).
After centrifugation, the supernatant is removed because the RNA is in the pellet.
The Pellet will be washed in cold 75% ETOH and then centrifuged at 12,000 (rpm/ref) for an additional 7 minutes.
The supernatant will be discarded and the pellet will be allowed to dry for five minutes.
The pellet should be re-suspended in 50 µl of DEPC water. If the pellet is having trouble going back into suspension, the solution might need to be gently heated.
After the pellet has gone into suspension, the RNA should be placed on ice.
The concentration of RNA will be determined using the Nanodrop and calculations will be conducted in order to ensure that 2µg of RNA will be found at the beginning of each amplification.
RNA may be frozen at this time at -80C degrees.

Reverse Transcription

A reaction for converting RNA into cDNA is as follows:
Determine the volume of RNA solution needed to make 2.0µL. of RNA, add 10.0µL of Master Mix, 3.0µl of oligo (dt) primer, and add enough RNase-free water for 29.0 µL total.
Centrifuge and incubate at 70C degrees for 5 minutes. After 5 minutes, transfer immediately to ice. Cool for 2 minutes and then add 1.0µL Superscript III reverse transcriptase (total volume is 30.0 µL).
Incubate at 42C degrees for 30 minutes.
Centrifuge and incubate at 90C degrees for 5 minutes.
Actin-B or 22Sribosomal subunit will be employed as a positive control.
Thaw Brilliant SYBR Green qftPCR mastermix and take precautions to protect from light.
Use 0.5mL centrifuge tubes.

Quantitative Reverse Transcription Polymerase Chain Reaction
qrtPCR
Set up the following reaction:
12.5µL qrtPCR mastermix
1.8 µL forward primer
2.0 µL reverse primer
5.7µL sterile RNase-free water
1.0 µL cDNA
This should add up to 23.0 µL.
Transfer each reaction to a 96 well plate and program the QPCR machine (which will need to be programmed with the appropriate data).





Analysis of Results

Determining any potential change in the transcription rate of mRNA for this gene using these variables will help to provide an understanding of the mechanism of action being employed by the lactone that was observed to antagonize cocaine in planarians. A significant change; either an increase or decrease in transcription may prove illuminating since dopamine receptors’ pharmacokinetics are challenging to predict (Suhara, et al., 2010).

Genes associated with the CNS are highly conserved across species. This is beneficial for two reasons; the primers have a good chance of being similar enough for the cDNA to produce similar results in other organisms. More significantly, high conservation of the basic genetic framework lends support for the possibility that understanding the relatively simple planarian system will eventually lead to an enhanced understanding of the more complex mammalian system that is exploited by drugs of addiction (Schwartz, et al., 2011).






Expected Outcomes/Alternative Approaches
Expected outcomes

The expected outcome of this effort is to quantify the change in the transcription/expression rate of one of the receptors and/or transporters in the dopaminergic pathway that is exploited by cocaine. The receptors seem to be down regulated and, because cocaine blocks the dopamine transporter (DAT). The synapse is flooded with excessive dopamine triggering a down regulation of the receptor. The logical expectation is to observe a lower transcription rate for the dopamine receptor in planarians exposed to cocaine and a higher transcription rate for planarians exposed to cocaine and γ-Nonalactone or the cocaine-Parthenolide combination compared with cocaine alone.
Actual results after the first round of qrtPCR: primers for the dopamine receptor did not arrive and the original primer sequence was not available. The β-Actin used as a positive control displayed multiple dissociations that suggest a lack of specificity for that particular locus.
New primer sequences for the β-Actin and the dopamine receptor were found.
Β-Actin primers have been graciously provided by Dr. Guangwen Chen.
Forward: ACACCGTACCAATCTATG
Reverse: GAGAAACTGTAACCTCGT

Dopamine Receptor primers have been provided by Dr.H. Agata.
Forward: CGAATTGGCGATCGACTTAAATCTGCAC
Reverse: TCCTATAATCGGGATTTTGTGAGCTTTCCA













Table 1 Primer Sequences to be Used in qrtPCR
Gene Source Forward Primer Reverse Primer Just Exon?
β-Actin Dr. Guangqwn Chen ACACCGTACCAATCTATG GAGAAACTGTAACCTCGT NO
Dopamine Receptor Dr. Agata CGAATTGGCGATCGACTTAAATCTGCAC TCCTATAATCGGATTTTGTGAGCTTTCCA YES
Dopamine Receptor
Dopamine Transporter DAT Jayanthi 5′-TAACCGCATTCTATGTGGATTTC-3′, exon 2) 5′-GTTGCACAATTGATGAATGATGTG-3′, exon 7) I think
yes
Alternative DAT (RB452: 5′-CAAATCTTCAGACGATCCCGACGAA-3′) (RB453: 5′-CTAGGATAATGAAAGTGGAAGACAC-3′)
I think yes



Alternative Approaches

Eventually, RNAi techniques will be applied in order to determine the role of various components of the planarian dopaminergic system play in cocaine toxicity and its alleviation when alkyl lactones were tested.
Another assay that has potential is a spectral analysis to determine the molecular structures that may provide information that will contribute to the general understanding of what is going on at the molecular level at the receptor site.








Part Three: Motility Tests help Determine Binding Specificity of Parthenolide and Gamma Nonalactone










Introduction

Finding a ligand that binds with a targeted receptor site with a high level of specificity is a desirable quality for several reasons. Binding specificity reduces the chances that a ligand will interact with other non-targeted receptor sites in the organism (Eckenhoff, 1999). Also, binding specificity diminishes competitive binding; a specific ligand-receptor will usually reduce the dose necessary to be effective. Parthenolide and Gamma nonalactone are being tested against other substances that are known to be neuronally active in order to determine whether the effect Parthenolide and Gamma Nonalactone have on cocaine is unique to the cocaine molecule.

Methods and Materials

Planarians will be observed in order to determine the number of “C-like positions” that are associated with disruption in the planarian CNS. The procedure is as follows:
An individual planarian will be placed in an observation well and submersed in an aqueous solution that will be part of a group of solutions: a control with 0.1% DMSO and APW, the substance being tested at an appropriate concentration, the substance being tested in tandem with Parthenolide at a concentration of 50µM concentration, and γ-Nonalactone at a concentration of 50µM.
The planarians will be pre-incubated in solution for ten minutes and will be observed for C-like positioning for ten minutes.
Data will be analyzed using Prism Graph Pad software and data will be subjected to ANOVA analysis. As of this writing, approximately 15 substances have been tested and none of the tested substances have been affected by either the Parthenolide or the γ-nonalactone.


Figure 15: Planaria being monitored for "C-like positions." Photo courtesy of Dr. One Pagan.
C-like positions are specific behaviors that planarians exhibit when exposed to chemicals that are known to work on the nervous system, particularly the D2 dopamine receptor cells (Raffa, et al., 2001; Venturini, et. al., 1989). Both ends of the animal become stiff and the middle of the body has a seizure-like response. The animal looks like the letter C.


Table 2 Substances Tested
Substance Tested Concentration Parthenolide Significant? γ-Nonalactone Significant?
1.0mM
Caffiene 1.0mM
Procaine 1.0mM
Dopamine 1.0mM 0.1mM
Acetylcholine 1.0mM
NMDA
Nicotine 1.0mM 0.1mM
Nicotine 0.5uM 0.1mM
Nicotine 0.25mM 0.1mM
Nicotine 0.10mM 0.1mM






Room for Improvement

Schmidtea mediterranea is presently not available for purchase in the United States and, as this is being penned, efforts are being made to secure a colony of S. mediterranea from Dr. Nester Oviedo’s lab. It will become necessary to achieve proficiency at propagating colonies of planarians.
Additionally, planarians seem to have some observable irregularities in their behavior that has yet to be explained. The surface area to volume ratio helps to account for individual differences but there seems to be more than one factor that creates an irregular pattern in planarians. There is some speculation that the planarians may be affected by some type of circadian-type rhythm that has not been identified.
Additionally, blindness should be incorporated into the observation process in order to reduce or eliminate the influence of test-giver bias. It is possible, for example, to decant the various solutions into individual 0.5 mL. containers and label the container with a code. The vials would be given to others to test afterwards; the code would be matched to its true identity.



Bibliography


Agata, K., Soejima, Y., Kato, K., Kobayashi, C., Umasono, Y., Watanabe, K. (1998) Structure of the planarian central nervous system (CNS) revealed by neuronal cell markers. Zoolog Sci. Jun 1;15(3):433-40.
Aguedo M, Ly MH, Belo I, TeixeiraJA, Belin JM, and Waché Y. (2004) Production of Aroma Compounds from Lipids. Food Technol Biotechnol 42:327–336.

Bawdekar AS, Kelkar GR, Bhattacharyya SC. (1966) Terpenoids LXXXIX absolute configuration of parthenolide. Tetrahedron Letters. 7:1225-1227.

Carranza,S., Littlewood, D T., Clough, K A., Ruiz-Trillo, I., Baguñà, J., and Riutort, M.(1998) A robust molecular phylogeny of the Tricladida (Platyhelminthes: Seriata) with a discussion on morphological synapomorphies. Proc Biol Sci. April 7; 265(1396): 631=640.

Calatayud, J. Gonzalez, A. (2005) History of the Development and Evolution of Local Anesthesia Since the Coca Leaf. Anesthesiology. V 98, No 6, jun 2005.

Eckenhoff RG, Tanner JW, Johansson JS. (1999) Steric hindrance is not required for n-alkanol cutoff in soluble proteins. Mol Pharmacol 56:414-418.

Ehrlich, S. (2008) Feverfew. University of Maryland Medical Center.
Franks NP and Lieb WR. (1985) Mapping of general anesthetic target sites provides a molecular basis for cutoff effects. Nature. 316:359-351.

Gentile, L., Cebria, F., Bartscherer, K., (2011) The planarian flatworm: an in vivo model for stem cell biology and nervous system regeneration . Published by The Company of Biologists Ltd PMCID: PMC3014342
Huson, D., Scornavacca, C., (2011) A Survey of Combinatorial Methods for Phylogenetic Networks. , Genome Biol Evol 3 23-35. doi: 10.1093/gbe/evq077

Heath H. (1907) A New Turbellarian from Hawaii. Proceedings of the Academy of Natural Sciences of Philadelphia 59:145-148.

Iversen, Leslie.(2009) Introduction to neuropsychopharmacology. Oxford University Press.
Jacobs, D., Hughes, N., Fitzgibbon, S., Winchell, C. (2005) Terminal addition, the Cambrian radiation and the Phanerozoic evolution of bilaterian form. EVOLUTION & DEVELOPMENT 7:6, 498–514
Jayanthi, L., Apparsundaram , S., Malone, M., Ward, E., Miller, D., Eppler, M. Blakely, R. (1998) The Caenorhabditis elegans GeneT23G5.5 Encodes an Antidepressant- and Cocaine-Sensitive Dopamine Transporter. Molecular Pharmacology October 1, 1998 vol. 54 no. 4 601-609.
Koehntop, D., -Chia , L, Van Bergen, F. (1977) Effects of Pharmacologic Alterations of Adrenergic Mechanisms by Cocaine, Tropolone, Aminophylline, and Ketamine on Epinephrine-induced Arrhythmias during Halothane-Nitrous Oxide Anesthesia. Anesthesiology Volume 46 - Issue 2 pp: 83-158
Koller,C. (1941) History of cocaine as a local anesthetic, JAMA 117: 1284
Lau, A. H., Knakievicz, T., Prá, D. and Erdtmann, B. (2007) Freshwater planarians as novel organisms for genotoxicity testing: Analysis of chromosome aberrations. Environmental and Molecular Mutagenesis, 48: 475–482. doi: 10.1002/em.20307
Margotta V, Caronti B, Meco G, Merante A, Ruggieri S, Venturini G and Palladini G.(1997) Effects of cocaine treatment on the nervous system of planaria (Dugesia gonocephala s.l.). Histochemical and ultrastructural observations. Eur J Histochem 41:223-30.

Mateo, Y. Budygin, E., Johansen, C. (2004) Role of Serotonin in Cocaine Effects in Mice with Reduced Dopamine Transporter Function. National Academy of Sciences

MATERIAL SAFETY DATA SHEET MSDS #GCC1-7 DIMETHYL SULFOXIDE (DMSO) August 20, 2004
McLure, H.and Rubin, A. (2005) Review of Local Anesthetic Agents. Anestesia 2005 ; 73: 59-74.
Mineta, K., Masumi, N., Cebria, F., Ikeo, K., Agata, K., Gojobori, T. (2003) Origin and evolutionary process of the CNS elucidated by comparative genomics analysis of planarian ESTs. PNAS June 24, 2003 vol. 100 no. 13 7666-7671

Mohr JT, Gribble GW, Lin SS, Eckenhoff RG and Robert S. Cantor RS. (2005) Anesthetic potency of two novel synthetic polyhydric alkanols longer than the n-alkanol cutoff: evidence for a bilayer-mediated mechanism of anesthesia? J Med Chem. 48:4172-4176.


Moreno y Maiz, T. (1868) Recherche cliniques et physiologiques sur l'érythoxylon coca du Perou et la cocaine. Thèse, 1868, Paris.

Okamoto K, Chimori M, Iwanaga F, Hattori T, Yanase H.(2002) Production of gamma-lactones by the brown-rot basidiomycete Piptoporus soloniensis. J Biosci Bioeng. 94(2):182-5.

Osborne, M., (2007) William Stewart Halsted: his life and contributions to surgery. The Lancet Oncology, Volume 8, Issue 3, Pages 256 - 265.

Pagán OR (2005) Synthetic local anesthetics as alleviators of cocaine inhibition of the human dopamine transporter. Ph.D. Dissertation, Field of Pharmacology and Department of Molecular Biology and Genetics, Cornell University, Ithaca, NY

Pagán OR, Rowlands AL, Fattore AL, Coudron T, Urban KR, Bidja AH, Eterovic VA. (2009) A cembranoid from tobacco prevents the expressionof nicotine-induced withdrawal behavior in planarian worms. Eur J Pharmacol 615:118–124.

Pagán OR, Rowlands AL and Urban KR. (2006)Toxicity and behavioral effects of dimethylsulfoxide in planaria. Neurosci Lett 2006; 407:274-8.

Pagán OR, Rowlands AL, Azam M, Urban KR, Bidja AH, Roy DM, Feeney RB, Afshari LK. Reversal of cocaine-induced planarian behavior by parthenolide and related sesquiterpene lactones. Pharmacol Biochem Behav 2008; 89:160-170.

Palladini G, Ruggeri S, Stocchi F, De Pandis MF, Venturini G, Margotta V. (1996) A pharmacological study of cocaine activity in planaria. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol 1996; 115:41-5.

Perfecto, I. and Vandermeer, J. (2008) Biodiversity Conservation in Tropical Agroecosystems. Annals of the New York Academy of Sciences, 1134: 173–200. doi: 10.1196/annals.1439.011

Personal Correspondence with Dr. Chen May 4, 2011.

Raffa RB and Desai P. (2005) Description and quantification of cocaine withdrawal signs in Planaria. Brain Res 2005; 1032:200-2.

Raffa RB, Holland LJ and Schulingkamp RJ.(2001) Quantitative assessment of dopamine D2 antagonist activity using invertebrate (Planaria) locomotion as a functional endpoint. J Pharmacol Toxicol Methods 2001; 45:223-6.

Raffa RB and Valdez JM. (2001) Cocaine withdrawal in Planaria. Eur J Pharmacol 2001; 430:143-5.
Reddien PW and Sanchez Alvarado A. (2004) Fundamentals of planarian regeneration. Annu Rev Cell Dev Biol 2004; 20:725–57.

Ribeiro P El-Shehabi F and Patocka N. (2005) Classical transmitters and their receptors in flatworms. Parasitology 131:S19–S40.

Rowlands AL, Pagán OR. (2008) Parthenolide prevents the expression of cocaine-induced withdrawal behavior in planarians. Eur J Pharmacol. 583:170-172.

Dr. Sanchez lecture. (2010) “Molecular Basis of Regeneration; Planarians as a Model System. http://www.youtube.com/watch?v=VQddTRqlD88&feature=relmfu

Sarnat HB and Netsky MG. (2002) When does a ganglion become a brain? Evolutionary origin of the central nervous system. Semin Pediatr Neurol. 9:240-53.

Scholz, A., (2011) Mechanisms of (local) anaesthetics on voltage‐gated sodium and other ion channels. British Journal of Anaesthesia.
Sarnat HB and Netsky MG. The brain of the planarian as the ancestor of the human brain. Can J
Neurol Sci 1985; 12:296-302.

Sofia M.C. Robb, Eric Ross and Alejandro Sánchez Alvarado. (2007) SmedGD; the Schmidtea mediterranea Genome Database. Nucleic Acids Research, 36:D599-D606, doi:10.1093/nar/gkm684 (e-publication date: September 18, 2007)
Schwartz, D., Bloom, D., Castro, R., Pagan, O., Jimenez-Rivera, C. (2011) Parthenolide Blocks Cocaine’s Effect on Spontaneous Firing Activity of Dopaminergic Neurons in the Ventral Tegmental Area. Neuropharmacology Volume 9, Number 1, March, 2011, pp. 17-20(4)
Suhara T Takahashi H,Takano H, Kodaka F, Arakawa R, Yamada M, Otsuka T, Hirano Y, Kikyo H, Okubo Y, Kato M, Obata T, Ito H, (2010) Contribution of dopamine D1 and D2 receptors to amygdala activity in human. J Neurosci 30:3043–3047
"Thomas H. Morgan - Biography". (2011)Nobelprize.orghttp://nobelprize.org/nobel_prizes/medicine/laureates/1933/morgan-bio.html
Vandam LD (1987) Some aspects of the history of local anesthesia. Handbook of Clin. Pharmacol 81:1-19
Volkow, N., Wang, D., Fowler, J., Logan, J. (1997) Decreased striatal dopaminergic responsiveness in detoxified cocaine-dependent subjects. Nature, Vol 386(6627), Apr 1997, 830-833.
Venturini, G, Stocchi, F., Margotta, V., Ruggieri, S., Bravi, D., Bellantuono, P., Palladini, G. (1989) A Pharmacological Study of Dopaminergic Receptors in Planaria. Neuropharmacology Vol. 28. No. 12. pp. 1377-1382.

Villar D and Schaeffer, DJ. (1995) Morphogenetic action of neurotransmitters on regenerating planarians-a review. Biomed Environ Sci 1993; 6:327-4

Volkow, N. D., Fowler, J. S., Wang, G.-J., Hitzemann, R., Logan, J., Schlyer, D. J., Dewey, S. L. and Wolf, A. P. (1993) Decreased dopamine D2 receptor availability is associated with reduced frontal metabolism in cocaine abusers. Synapse, 14: 169–177. doi: 10.1002/syn.890140210

Von Oettingen ,W. F. (1933) the earliest suggestion of the use of cocaine for local anesthesia. Ann Med Hist (NS)5: 275-280, 1933
Yentis, S., Vlassakov, K. (1999) Vassily von Anrep, Forgotten Poineer of Regional Anesthesia. Anesthesiology: March, 1999-Volume 90-Issue 3-p890-895.

















Appendix






D2 Receptor Availability in a Normal (L) Brain and Brain of a Long-Term Cocaine Addict (R)

Figure 17: Difference in Dopamine (2) receptor
Figure 18 NIH


Figure 19: Activity Curve for Gamma Nonalactone



Figure 20: Needs to give someone credit.
The next figure needs to be formatted properly.




Table 3, Data Analysis of Surface Area to Volume
Table Analyzed Data 1
Column A Small
vs Vs
Column B Large

Unpaired t test
P value 0.0260
P value summary *
Are means signif. different? (P < 0.05) Yes
One- or two-tailed P value? Two-tailed
t, df t=2.426 df=18

How big is the difference?
Mean ± SEM of column A 2.320 ± 0.06048 N=10
Mean ± SEM of column B 2.170 ± 0.01282 N=10
Difference between means 0.1500 ± 0.06182
95% confidence interval 0.02011 to 0.2799
R squared 0.2464

F test to compare variances
F,DFn, Dfd 22.24, 9, 9
P value < 0.0001
P value summary ***
Are variances significantly different? Yes