Monday, January 16, 2012
A word about Formatting
The thesis is too large for one post and the formatting is wonky but if you want to take a chunk and help with flow and spelling/grammar, go for it.
Almost parts 3 and 4
In light of this information, results showing that parthenolide
prevented the behavioral effects of cocaine but not amphetamine was unexpected,
since cocaine and amphetamines both interact with neurotransmitter
transporters, albeit through different mechanisms. Cocaine is a reuptake
blocker, preventing the transport of the neurotransmitter back to the
presynaptic site; amphetamine is considered a “releaser”, which acts as a false
substrate of the transporter (Riddle et al., 2005). In both cases, the net
result is the abnormal increase of neurotransmitter molecules in the synaptic
cleft, which accounts for the drug’s psychoactive properties (Iversen, 2006;
Sager and Torres, 2011).
Using
vertebrate pharmacology as a point of reference, our results suggests that
parthenolide prevents the pSLM induced by cocaine by inhibiting an interaction
with dopaminergic systems. However, this is not consistent with the amphetamine
results (Figure 1E) or by the fact that no significant pSLMs are detected when
exposing the worms to a dopamine concentration of 1 mM (data not shown).
Interestingly, preliminary results with another planarian species, Dugesia
dorotocephala, seem to indicate that parthenolide alleviates
amphetamine-induced pSLM (Rawls et al., unpublished data). A possible
interpretation is that in planarians, any catecholamine responses are modulated
by compounds such as norepinephrine, octopamine or tyramine, as opposed to
dopamine. Another implication of our results is that the pSLM are induced by
cocaine/amphetamines and by cholinergic/glutamatergic compounds by interacting
with different protein targets. This is amenable to pharmacological dissection
of these distinct mechanisms.
In future experiments, we will study the effect of parthenolide against
cocaine and amphetamine-like compounds in planarian behavior using paradigms
such as conditioned place preference (Rawls et al., 2011), cross-sensitization
(Rawls et al., 2010) and withdrawal-like behavior (Sacavage et al., 2008).
In a broader
context, this work highlights the usefulness of planarians as an important
animal model in pharmacology. In addition to the multiple advantages of using
planarians described above, this model has been demonstrated to be relevant to
mammalian pharmacology (Schwarz, 2011). Furthermore, since they can be studied
all the way from molecular biology to behavior, these organisms will likely be
developed as important tools in drug discovery research.
Part Four, Using and Seizure-like Responses to Determine
Gain of Function in the Planarian Regenerating Brain
Introduction
When planarian
regeneration is taken into consideration along with the lack of responsiveness
in decapitated planarians that are exposed to cocaine, it is logical to
consider utilizing this information in order to help determine the onset of
function in the regenerating brain in planarians. Planarians have the highest concentration of
adult Pluripotent stem cells found in any animal species (cite.) This affords a
unique opportunity to be able to observe the onset of function in regenerating
cells in a centralized nervous system.
Although there is relatively little plasticity in mammalian CNS, enough
homology exists between genes that govern the formation and expression of the CNS
(between species) some of the results gained from such observations have the
potential to contribute to the understanding of when these systems cross a
threshold needed to go from not functional to functional.
Experimental Design
Planarians that were selected
to be of similar size were selected and placed in a vial of APW and a similar
cohort of planarians were decapitated and placed in an identical vial of APW.
Both groups were segregated on Day 0.
The first of a set of observations was conducted on Day 0. Each
planarian was placed in an observation well and immersed in a solution of APW
or 1mM solution of cocaine and observed for seizure-like positions for ten
minutes. Four observations were made for each of the following: Control Intact,
Control Decapitated (on Day Zero) or Regenerating (From Day One through Day
Seven), Cocaine Intact, Cocaine Decapitated (on day Zero) or Regenerating (From
Day One through Day Seven.) This set of observations was repeated on Day 2, 4,
5, 6, and 7.
When Seizure-like positions
are observed in regenerating planarians, there is a strong likelihood that the
brain has regenerated to the degree that function has been sufficiently restored
such that the effect of cocaine upon the nervous system of the regenerating
planarians is able to respond to the cocaine in a quantifiable and replicable
way.
Graph
2
A
Comparison of Seizure-like Responses in Intact Vs. Decapitated Planarians
This graph demonstrates
results in intact and decapitated planarians in the presence and absence of
cocaine. All of the decapitated
planarians (control, cocaine, and the combination of cocaine and Parthenolide)
display no significant response. The intact planarians’ control elicits no
response while the intact planarian in the solution of cocaine demonstrates
seizure-like positions at a rate that is consistent with previous
observations. Similarly, when the
solution of cocaine is augmented with Parthenolide at a concentration of 50ยตM, the seizure-like behavior is reduced by
approximately 50%.
Figure 1: Comparing Planarian
Seizure-Like Movements
Figure 1 comparing the frequency of seizure-like movements in L-glutamic
acid (p=0.491), NMDA (p=0.0007), Nicotine (p=0.592), and Cocaine (p=0.00002). A
two-tailed paired t-test was conducted on each data set (intact verses
decapitated.)
Figure
2
Difference
Between Groups on the Same Day
Day
|
P-value
|
Significant?
|
0
|
0.005008
|
Yes
|
2
|
0.011431
|
Yes
|
4
|
0.009077
|
Yes
|
5
|
0.230201
|
No
|
6
|
0.134488
|
No
|
7
|
0.099728
|
No
|
This figure
is the result of a Two-tailed T-test comparing the number of seizure-like
positions of intact planarians with regenerating planarians on a given day.
When the p-value is not significant (significance is 0.05%). When the transition from significance to that
of no significance difference is realized, there is reason to believe these
data support the presence of a brain that is necessary to elicit the response
that is being observed.
Graph
3
Control,
Seizure Like Positions (or the lack thereof) in Intact and Decapitated
Planarians
This graph establishes
controls elicit no significant seizure-like behaviors in planarians.
Graph
Four
Seizure-like
Positioning in Intact and Decapitated Planarians Upon Exposure to Cocaine at
1mM Concentration
Figure X
shows seizure like positions in intact and regenerating planarians over a
period of seven days. The sample size
for days 0-6 was n=4. On Day 7, the
sample size was n=3. Data were evaluated
using a 2-way ANOVA with a p-value of 0.02.
Discussion
This series of
observations afforded an opportunity to unite the disciplines of
neuropharmocology with regenerative biology by employing the unique properties
that planarians enjoy as a result of their regenerative abilities. Naturally, the results, while substantive,
have raised more questions about the nature of the structures in the planarian
brain that are recruited when exposed to cocaine. The partial reduction of seizure-like
behavior when planarians are exposed to NMDA is also sparking questions. What
is causing this partial antagonism of the normal neuronal response upon
exposure to NMDA? Are two different receptors affected by NMDA? Is there a
common pathway shared by whatever is being used upon exposure to cocaine?
While cocaine
works on the dopaminergic and serotonergic pathways, Cytisine affects nicotinic
acetylcholine receptors. In the
meantime, NMDA is known to affect the Glutamate/GABA pathways (cite sources.)
.
Additional Information
About the Experimental Design for NMDA
Seizure-like behavior for NMDA was reduced to 50%
of its normal levels when planarians were decapitated (unpublished data.) The
objective of this experiment is to determine when the planarian brain has
recovered the ability to express seizure like positions at normal levels when
the planarian has regenerated its brain. NMDA levels are at 1.0 mM
concentration.
Approximately 50 planarians (D. tigrina) will serve as the intact
controls while 50 were decapitated on Day Zero.
Starting on Day Zero, observations were conducted
in order to quantify the number of seizure-like positions an individual planarian
makes in ten minutes when immersed in a solution of NMDA at a concentration of
1.0mM. Observations were made between 8
and 11 AM in order to provide consistency and rule out differences that were a
result of circadian rhythms.
Sample size is n=4 for each of the following;
Control Intact, Control Decapitated/Regenerating, NMDA Intact, NMDA
Decapitated/Regenerating. Observations will be made on Day Zero, 2, 4, 5, 6,
and 7.
Additional Information About the Experimental Design of Cytisine
Figure 16: Cytisine Molecule
(Public Domain)
|
One of the
more fascinating elements of this study is the notion that these three
compounds tend to work within three separate neurotransmission pathways.
Cocaine works within the dopaminergic and serotonergic pathways while Cytisine
works with the Acyetlcholine pathways and NMDA uses the GABA/Glutamic
system.
Future
Direction
It is the nature of
Hypothesis Testing to finish with more questions to explore than those that
were answered or even initially asked.
There are several avenues of exploration that have presented themselves
among them include but are not limited to establishing any pattern of change in
the transcription rate of structures such as the Dopamine Transporter, Dopamine
and Serotonin receptor sites. Conducting assays to detect metabolites of
suspected ligands or neurotransmitters would also provide clues to piece
together a larger neuropharmacological picture.
Another direction would
be to continue work with the human embryonic kidney cells that were transfected
with the dopamine transporter. Receptors
and serotonergic receptors and transporters could also be transfected into this
cell line.
With respect to the
regeneration studies, it would be helpful to track the regeneration of ganglion
as well as the regeneration of receptor sites in order to correlate their
appearance with gain of function. This
could be augmented by a microarray, perhaps a microarray could be conducted at
the same time the p-slp observations are made.
Room
for Improvement
Schmidtea mediterranea is presently not available
for purchase in the United States and, as this is being penned, efforts are
being made to secure a colony of S.
mediterranea from Dr. Nester Oviedo’s lab.
It will become necessary to achieve proficiency at propagating colonies
of planarians. Maintaining a colony of
S. mediterranea would increase the
efficiency of genetic analysis that is important when investigating the
molecular mechanism(s) of action at the transcriptional level. Getting primers from Dugesia japonica to work with Dugesia tigrina
with genetic sequences of Schmidtea mediterranea is precarious at best and a
waste of time and reagents at worst.
Additionally,
planarians seem to have some observable irregularities in their behavior that
has yet to be explained. The surface area to volume ratio helps to account for
individual differences but there seems to be more than one factor that creates
an irregular pattern in planarians.
There is some speculation that the planarians may be affected by some
type of circadian-type rhythm that has not been identified.
Finally, blindness
should be incorporated into the observation process in order to reduce or
eliminate the influence of test-giver bias.
It is possible, for example, to decant the various solutions into
individual 5.0 mL. containers and label the container with a code. The vials would be given to others to test
afterwards; the code would be matched to its true identity.
Parts 1 and 2
Part One
Determining
Which Lactones Antagonize Cocaine
Part One
Determining
Which Lactones Antagonize Cocaine
Introduction
Testing response in
planarians when exposed to cocaine and various gamma lactone structures
Determining the
simplest structure that antagonizes cocaine
qrtPCR assays to detect
and quantify significant changes in transcription and/or expression rates for
various genes in the dopaminergic pathways.
Testing other
neuronally active compounds in order to establish anything found to antagonize
cocaine does so with specificity.
Methods
and Materials
Animals and
chemicals: Brown planarian worms (Dugesia tigrina) were purchased from Ward’s (Rochester,
NY). General laboratory materials and
supplies were obtained from Fisher Scientific (Suwanee, GA) or Sigma-Aldrich
(St. Louis, MO); (-) Cocaine hydrochloride was purchased from Sigma-Aldrich
(St. Louis, Mo). The tested Alkyl
gamma-lactones were purchased from Chromadex (Irvine, CA).
General
Procedure
The first molecules to be examined were the
five sided ringed structure known as gamma lactones. Gamma lactone structures
were systematically tested starting with the simplest structure and progressing
to sequentially longer hydrocarbon chains.
The simplest gamma
lactone tested was gamma Valerolactone. C5H8O2.
The lactone with the longest hydrocarbon chain was gamma Dodecalactone
C12H22O2
Figure
10: Gamma Lactones Used in Study
The concentration of
each lactone tested was determined by testing planarians in solution with
decreasing concentration of lactones until the activity level of planarians in
solution demonstrated no significant variation from the control.
For every trial, a set
of controls was also conducted and the activity of the planarians subjected to
various lactones with or without cocaine was compared to their corresponding control.
Each planarian was
tested once and euthanized with 0.2 M HCl.
Figure 11: Planaria Being Observed
for Motility. Photo courtesy One Pagan, PhD.
|
Planarian movement was
tested by placing an individual planarian in a 6cm diameter petri dish with the
specified solution containing the specified concentration added. The petri dish
was pre-rinsed in APW (Artificial Pond Water composed of NaCl, CaCl2, NaHCl3
and Distilled H2O) and covered. Each individual was pre-incubated in solution for
10 minutes and the petri dish was set on a grid whose lines formed 1cm squares.
When timing commenced, planarians were perturbed by swirling the solution in the
dish. Notations were made when the planarians crossed the 1cm hash mark.
Movement was documented every minute for a total of five minutes for every
observation.
Gamma
Lactones Used in this Observation
| <><><> > |
Concentration
|
<><><>
>
ฮณ-Valerolactone
|
<><><>
>
203 ยตM
|
<><><>
>
ฮณ-Hexalactone
|
<><><>
>
195 ยตM
|
<><><>
>
ฮณ-Heptalactone
|
<><><>
>
100 ยตM
|
<><><>
>
ฮณ-Octalactone
|
<><><>
>
100 ยตM
|
<><><>
>
ฮณ-Nonalactone
|
<><><>
>
51 ยตM
|
<><><>
>
ฮณ-Decalactone
|
<><><>
>
10 ยตM
|
<><><>
>
ฮณ-Dodecalactone
|
<><><>
>
10 ยตM
|
<><><>
>
Cocaine was tested at a
concentration of 200 ยตm.
0.1% DMSO was included
in all solutions including controls.
Data were analyzed
using Prism Graph Pad software and the data were subjected to regression
analysis using a two-tailed t-test.
Surface
Area to Volume Ratio
The intensity of
responses that planarians demonstrate upon exposure to cocaine is influenced by
the surface area to volume ratio of the individual planarian. Motility in very small and very large
individual planarians can be different from individuals that are within one
standard deviation of the mean. This
potential problem is resolved by selecting planarians by size. Planarians also
need to be starved for at least one week in order to eliminate possible interactions
with nutrients and/or metabolites associated with digestion. After testing responses in planarians that
were either extremely small (<1cm) or extremely large (>2cm,) the small
individuals responded more vigorously to something that elicited a neurological
response and the large individuals generally needed a higher concentration to
exhibit a response. This correlates to
the surface area to volume ratio. Because of this phenomenon, planarians were
selected for observation based upon their size. Individuals between 1 and 2 cm
were selected for observation.
Figure 12: Difference in Motility
Comparing Extremely Small and Extremely Lare Planarians
Results
The
Effect of ฮณ-Lactones on Planarian Motility
Figure 13 shows a
series of concentration-response curves of planarian motility. Motility
decreases as a function of ฮณ-lactone concentration. The three smaller lactones
(Valerolactone, Hexalactone, and Heptalactone) did not inhibit planarian
motility at concentrations below 500 ยตM.
The larger lactone
structures (Octalactone, Nonalactone, Decalactone and Dodecalactone) decreased
planarian motility in a concentration-dependent manner. The least potent in the
latter group of compounds was Octalactone which had an IC₅₀ of
approximately 426 ยตM while the most active compound, Decalactone
displays an IC₅₀
43ยตM.
Motility
as a Function of ฮณ-Lactone Concentration
Figure
13: Motility as a Function of
Concentration
Appendix Table 2 illustrates
the results of parallel experiments using 200 ฮผM cocaine in the absence and in
the presence of a single ฮณ-lactone concentration at which the lactone did not
induce motility decrease by itself. Cocaine at a concentration of 200 ฮผM
decreased planarian motility by about 50 % (Figure 14), which is consistent
with previously reported results (Pagรกn, et al., 2008).
The only compound
capable of antagonizing cocaine effectively
was ฮณ-nonalactone, which, at a concentration of about 50ฮผM, significantly
alleviated the 200ฮผM cocaine-induced motility decrease from about 51% (cocaine
alone) to about 12% (cocaine + ฮณ-nonalactone, )
See Appendix Table 2. Figure 14
demonstrates ฮณ-nonalactone’s effect on cocaine-induced motility decrease as
concentration-dependent and becomes synergistic with cocaine at ฮณ-nonalactone
concentrations higher than 75ฮผM.
Results for ฮณ-Nonalactone
Figure 14: Results for Gamma
Nonalactone expressed at a fraction of the control.
This work has established the ฮณ-lactone
moiety associated to a 5-carbon methyl tail attached to position 4 in the
lactone ring (ฮณ-nonalactone, Figure 15.) to be the minimum structure necessary
to reverse cocaine-induced mobility inhibition in planarians. This is
consistent with previous work which indicated that the lactone ring in this
class of compounds is essential for their cocaine-antagonist effect in this
experimental system (Pagรกn, et al., 2008).
The results, however, indicate that the ฮณ-lactone moiety is not
sufficient to antagonize cocaine effects because none of the other lactones
that were tested demonstrated any significant alleviation of cocaine-related
symptoms in planarians. We also
determined that the ฮณ-nonalactone effect on cocaine was
concentration-dependent, suggesting that ฮณ-nonalactone and cocaine compete for
a specific binding site in planarians, presumably a protein receptor.
Additional evidence in favor of a common or overlapping binding site for cocaine
and the ฮณ-nonalactone can be deduced by the observation that ฮณ-lactones with
alkyl chains longer than 5 carbons decrease motility by themselves yet they are
inactive antagonists against cocaine.
This
phenomenon is somewhat reminiscent of the cutoff effect observed in some types
of general anesthetic molecules. The cutoff effect is the increase in
anesthetic potency of a homologous series of compounds, for example, n-alkanes
or n-alkanols among others, up to a point where a decrease (or even total loss)
of the anesthetic effect is observed in higher molecular weight compounds (Eckenhoff
et al., 1999). This effect is frequently used to estimate the molecular
dimensions of protein targets (Eckenhoff , et al., 1999; Franks and
Lieb, 1985), but other interpretations, including the interaction of the
anesthetic compounds with membranes, as opposed to proteins, has also been
proposed (Mohr, 2005). It is possible that we are observing a mechanism similar
to the cutoff effect in these ฮณ-lactones/cocaine experiments.
Interestingly, the biggest lactone tested, Dodecalactone,
is very similar to Parthenolide in terms of its molecular weight, yet Dodecalactone
was inactive against cocaine. This indicates that molecular size must not be
the only property that influences parthenolide's (or the ฮณ-lactones)
anti-cocaine properties.
Another consideration that is being
explored is the ratio of optic R to S enantiomers found in the various lactones
as well as in Parthenolide. Preliminary findings suggest Octalactone as well as
Decalactone favor the R configuration while both parthenolide and nonalactone
are either a racemic mixture, have a slight S leaning R to S ratio or favor the
S confirmation (get data and facts.)
Similar
Results in Mammals
Parthenolide has
recently been administered to rats that had been exposed to, “acute,”
injections of cocaine. Parthenolide has been found to block the inhibitory
effect of cocaine upon the dopamine neurological firing rate in the rats. In mammalian systems, cocaine works on the
ventral tegmental area of the dopaminergic network which is associated with
motivation and reward. These more
sophisticated pathways do not exist in planarian systems but it is significant
that Parthenolide seems to inhibit the activity of cocaine using a pathway in a
mammalian subject that is not found in the planarian brain (Schwartz, et al., 2011).
Part Two: Determining
how the Transcription Rate of Dopamine Receptors is Affected by Parthenolide
and Gamma Nonalactone
Introduction
Our lab has recently
had a paper published in which we have documented the alkyl ฮณ -lactone
structure with a four carbon hydrocarbon chain as the least substituted
structure necessary to antagonize the effect cocaine has on the nervous system
of planarian worms (Baker, et al., 2011).
The mechanism of action is not known but cocaine is known to obstruct
the dopamine transporter protein (Mateo, et al., 2004). It is also known to decrease the number of
post-synaptic dopamine receptors in humans that abuse cocaine (Volkow, 1997). As
a result, understanding the changes in transcription in RNA that is translated
into the Dopamine transporter protein and associated membrane proteins may be
illuminating.
Methods
RNA is isolated from planarians
Planarians of a uniform
size are separated into four discrete groups according to their treatment. The
first group was the control that had been exposed to artificially formulated
pond water (APW) and Dimethyl Sulfoxide (DMSO) at 0.1%. Another group has been exposed to cocaine at
a concentration of 200 ยตM.
A third group will be exposed to a combination of cocaine at 200 ยตM
and gamma nonalactone at a concentration of 50 ยตM. The fourth group will be a combination of
cocaine at 200 ยตM
and Parthenolide at 50 ยตM. All four groups will be placed in
solution with DMSO at a 0.1% concentration.
The planarians will be
decapitated and their heads will be harvested and homogenized. mRNA will be isolated and the transcription
rate for genes of interest will be evaluated by running each group through a
qrtPCR procedure. The results will be
compared in such a way that any significant differences between the control and
the other variable being tested will be analyzed.
The
procedure is as follows:
RNA
isolation
Approximately ten planarians
will be allocated to each of the four treatments and each group was
pre-incubated in its respective solution for ten minutes after which time, they
were euthanized, decapitated, and placed in 0.5mL Trizol. Care was taken to avoid dilution of Trizol when transferring planarians to the container of
Trizol. After the planarians were in Trizol, they were homogenized using a
Power Gen 125 homogenizer. At this point, the cells have been lysed and
organelles are able to be fractionated.
100ยตL.
of chloroform was then added in a microfuge tube and the mixture the mixture
was then gently shaken for 15 seconds and was allowed to incubate at room
temperature (approximately 20 degrees, C.) for 5 minutes.
The mixture was then centrifuged at 12,000
rpm/ref. for a total time of ten minutes.
Up until this point,
the rationale for this procedure is as follows: Trizol is used to lyse
membranes and allow the contents of the cell to become available. Trizol aids
in the homogenation process. Chloroform has
an affinity for RNA and helps it go into solution while the Trizol and other
organic material precipitate out of solution.
RNA is isolated with
the top layer and then precipitated out of solution with the addition of
isoproponol.
The Pellet was washed
in cold 75% ETOH and then centrifuged at 12,000 (rpm/ref) for an additional 7
minutes.
The supernatant will be
discarded and the pellet will be allowed to dry for five minutes.
The pellet should be
re-suspended in 50 ยตl of DEPC water. If the pellet is having trouble going back
into suspension, the solution might need to be gently heated.
After the pellet had
gone into suspension, the RNA should be placed on ice.
The concentration of
RNA was determined using the Nanodrop and calculations will be conducted in
order to ensure that 2ยตg of RNA will be found at the beginning
of each amplification.
RNA may be frozen at
this time at -80C degrees.
Reverse
Transcription
A reaction for
converting RNA into cDNA is as follows:
Determine the volume of
RNA solution needed to make 2.0ยตL. of RNA, add 10.0ยตL
of Master Mix, 3.0ยตl of oligo (dt) primer, and add enough RNase-free water for
29.0 ยตL total.
Centrifuge and incubate
at 70C degrees for 5 minutes. After 5 minutes, transfer immediately to ice.
Cool for 2 minutes and then add 1.0ยตL Superscript III
reverse transcriptase (total volume is 30.0 ยตL).
Incubate at 42C degrees
for 30 minutes.
Centrifuge and incubate
at 90C degrees for 5 minutes.
Actin-B or 22Sribosomal
subunit will be employed as a positive control.
Thaw Brilliant SYBR
Green qftPCR mastermix and take precautions to protect from light.
Use 0.5mL centrifuge
tubes.
Quantitative
Reverse Transcription Polymerase Chain Reaction
qrtPCR
Set up the following
reaction:
12.5ยตL
qrtPCR mastermix
1.8 ยตL
forward primer
2.0 ยตL
reverse primer
5.7ยตL
sterile RNase-free water
1.0 ยตL
cDNA
This should add up to
23.0 ยตL.
Transfer each reaction
to a 96 well plate and program the QPCR machine
(which will need to be programmed with the appropriate data).
Analysis
of Results
Determining any
potential change in the transcription rate of mRNA for this gene using these
variables will help to provide an understanding of the mechanism of action
being employed by the lactone that was observed to antagonize cocaine in
planarians. A significant change; either
an increase or decrease in transcription may prove illuminating since dopamine
receptors’ pharmacokinetics are challenging to predict (Suhara, et al., 2010).
Genes associated with
the CNS are highly conserved across species. This is beneficial for two reasons; the
primers have a good chance of being similar enough for the cDNA to produce
similar results in other organisms. More significantly, high conservation of
the basic genetic framework lends support for the possibility that
understanding the relatively simple planarian system will eventually lead to an
enhanced understanding of the more complex mammalian system that is exploited
by drugs of addiction (Schwartz, et al., 2011).
Normal controls are
being employed to increase confidence in the results. A negative control,No RT
cDNA has identified contaminated RNA and those tests have been repeated. Positive controls namely No Primers and No
Template were also incorporated in the procedure to elevate the confidence in
this experimental design.
Expected
Outcomes/Alternative Approaches
Expected
outcomes
The expected outcome of
this effort is to quantify the change in the transcription/expression rate of
one of the receptors and/or transporters in the dopaminergic pathway that is
exploited by cocaine. The receptors seem
to be down regulated and, because cocaine blocks the
dopamine transporter (DAT). The synapse
is flooded with excessive dopamine triggering a down regulation of the receptor.
The logical expectation is to observe a lower transcription rate for the
dopamine receptor in planarians exposed to cocaine and a higher transcription
rate for planarians exposed to cocaine and ฮณ-Nonalactone or the
cocaine-Parthenolide combination compared with cocaine alone.
Actual results after
the first round of qrtPCR: primers for the dopamine receptor did not arrive and
the original primer sequence was not available. The ฮฒ-Actin used as a positive
control displayed multiple dissociations that suggest a lack of specificity for
that particular locus.
New primer sequences
for the ฮฒ-Actin and the dopamine receptor were found.
ฮ-Actin primers have
been graciously provided by Dr. Guangwen Chen.
Forward:
ACACCGTACCAATCTATG
Reverse:
GAGAAACTGTAACCTCGT
Dopamine Receptor
primers have been provided by Dr.H. Agata.
Forward:
CGAATTGGCGATCGACTTAAATCTGCAC
Reverse:
TCCTATAATCGGGATTTTGTGAGCTTTCCA
Dopamine 1Receptor
primers (provided by Dr. Agata.)
CGAATTGGCGATCGACTTAAATCTGCAC
TCCTATAATCGGGATTTTGTGAGCTT
Table
1 Primer Sequences to be Used in qrtPCR
Gene
|
Source
|
Forward Primer
|
Reverse Primer
|
Just Exon?
|
ฮฒ-Actin
|
Dr. Guangqwn Chen
|
ACACCGTACCAATCTATG
|
GAGAAACTGTAACCTCGT
|
NO
|
Dopamine Receptor
|
Dr. Agata
|
TCCTATAATCGGATTTTGTGAGCTTTCCA
|
YES
|
|
Dopamine
Receptor
|
||||
Dopamine
Transporter DAT
|
Jayanthi
|
5′-TAACCGCATTCTATGTGGATTTC-3′, exon 2)
|
5′-GTTGCACAATTGATGAATGATGTG-3′, exon 7)
|
I think
yes
|
Alternative DAT
|
(RB452: 5′-CAAATCTTCAGACGATCCCGACGAA-3′)
|
(RB453: 5′-CTAGGATAATGAAAGTGGAAGACAC-3′)
|
I think yes
|
|
Results
The results
of this observation have been hindered because the genome of D. tigrina seems unstable and the S. mediterranea that the lab has received
have not been viable and have certainly not been able to propagate colonies
sufficient to supply enough tissue to isolate RNA. A survey of peer-reviewed literature reveals
very little information about the normal pattern of a gel of rRNA for D.
tigrina and the gels I have been able to find were not configured in the normal
large and smaller band way that is the expected pattern for eukaryotes.
Discussion
Discussion
will vary depending upon future direction.
As of this writing, a colony of S. mediterranea
has not been secured sufficiently to isolate enough RNA to carry on a qrtPCR as
detailed in Part Two.
Alternative
Approaches
Eventually, RNAi
techniques will be applied in order to determine the role of various components
of the planarian dopaminergic system play in cocaine toxicity and its
alleviation when alkyl lactones were tested.
The immediate
issue that has prevented the genetic analysis to be conducted efficiently is
the questionable stability of the D. tigrigna’s
genome. The double bands of 22s ribosomal gel ladder was not evident, even after the
procedure was observed by Dr. Gestl in order to detect human error. Two separate donations of S. mediterranea were not able to survive
under the care of members of the Pagan Lab.
Eventually, these problems will be resolved and S. mediterranea will replace D. tigrina.
S. mediterranea has a stable genome which opens up the world of microarrays,
Blotting, and RNAi.
Another assay that has
potential is a spectral analysis to determine the molecular structures that may
provide information that will contribute to the general understanding of what
is going on at the molecular level at the receptor site.
Subscribe to:
Posts (Atom)