Part One
Determining
Which Lactones Antagonize Cocaine
Part One
Determining
Which Lactones Antagonize Cocaine
Introduction
Testing response in
planarians when exposed to cocaine and various gamma lactone structures
Determining the
simplest structure that antagonizes cocaine
qrtPCR assays to detect
and quantify significant changes in transcription and/or expression rates for
various genes in the dopaminergic pathways.
Testing other
neuronally active compounds in order to establish anything found to antagonize
cocaine does so with specificity.
Methods
and Materials
Animals and
chemicals: Brown planarian worms (Dugesia tigrina) were purchased from Ward’s (Rochester,
NY). General laboratory materials and
supplies were obtained from Fisher Scientific (Suwanee, GA) or Sigma-Aldrich
(St. Louis, MO); (-) Cocaine hydrochloride was purchased from Sigma-Aldrich
(St. Louis, Mo). The tested Alkyl
gamma-lactones were purchased from Chromadex (Irvine, CA).
General
Procedure
The first molecules to be examined were the
five sided ringed structure known as gamma lactones. Gamma lactone structures
were systematically tested starting with the simplest structure and progressing
to sequentially longer hydrocarbon chains.
The simplest gamma
lactone tested was gamma Valerolactone. C5H8O2.
The lactone with the longest hydrocarbon chain was gamma Dodecalactone
C12H22O2
Figure
10: Gamma Lactones Used in Study
The concentration of
each lactone tested was determined by testing planarians in solution with
decreasing concentration of lactones until the activity level of planarians in
solution demonstrated no significant variation from the control.
For every trial, a set
of controls was also conducted and the activity of the planarians subjected to
various lactones with or without cocaine was compared to their corresponding control.
Each planarian was
tested once and euthanized with 0.2 M HCl.
Figure 11: Planaria Being Observed
for Motility. Photo courtesy One Pagan, PhD.
|
Planarian movement was
tested by placing an individual planarian in a 6cm diameter petri dish with the
specified solution containing the specified concentration added. The petri dish
was pre-rinsed in APW (Artificial Pond Water composed of NaCl, CaCl2, NaHCl3
and Distilled H2O) and covered. Each individual was pre-incubated in solution for
10 minutes and the petri dish was set on a grid whose lines formed 1cm squares.
When timing commenced, planarians were perturbed by swirling the solution in the
dish. Notations were made when the planarians crossed the 1cm hash mark.
Movement was documented every minute for a total of five minutes for every
observation.
Gamma
Lactones Used in this Observation
<><><>
<><><>
<><><>
<><><>
<><><>
<><><>
<><><>
<><><>
<><><>
<><><>
<><><>
<><><>
<><><>
<><><>
<><><>
<><><>
Concentration
|
|
γ-Valerolactone
|
203 µM
|
γ-Hexalactone
|
195 µM
|
γ-Heptalactone
|
100 µM
|
γ-Octalactone
|
100 µM
|
γ-Nonalactone
|
51 µM
|
γ-Decalactone
|
10 µM
|
γ-Dodecalactone
|
10 µM
|
Cocaine was tested at a
concentration of 200 µm.
0.1% DMSO was included
in all solutions including controls.
Data were analyzed
using Prism Graph Pad software and the data were subjected to regression
analysis using a two-tailed t-test.
Surface
Area to Volume Ratio
The intensity of
responses that planarians demonstrate upon exposure to cocaine is influenced by
the surface area to volume ratio of the individual planarian. Motility in very small and very large
individual planarians can be different from individuals that are within one
standard deviation of the mean. This
potential problem is resolved by selecting planarians by size. Planarians also
need to be starved for at least one week in order to eliminate possible interactions
with nutrients and/or metabolites associated with digestion. After testing responses in planarians that
were either extremely small (<1cm) or extremely large (>2cm,) the small
individuals responded more vigorously to something that elicited a neurological
response and the large individuals generally needed a higher concentration to
exhibit a response. This correlates to
the surface area to volume ratio. Because of this phenomenon, planarians were
selected for observation based upon their size. Individuals between 1 and 2 cm
were selected for observation.
Figure 12: Difference in Motility
Comparing Extremely Small and Extremely Lare Planarians
Results
The
Effect of γ-Lactones on Planarian Motility
Figure 13 shows a
series of concentration-response curves of planarian motility. Motility
decreases as a function of γ-lactone concentration. The three smaller lactones
(Valerolactone, Hexalactone, and Heptalactone) did not inhibit planarian
motility at concentrations below 500 µM.
The larger lactone
structures (Octalactone, Nonalactone, Decalactone and Dodecalactone) decreased
planarian motility in a concentration-dependent manner. The least potent in the
latter group of compounds was Octalactone which had an IC₅₀ of
approximately 426 µM while the most active compound, Decalactone
displays an IC₅₀
43µM.
Motility
as a Function of γ-Lactone Concentration
Figure
13: Motility as a Function of
Concentration
Appendix Table 2 illustrates
the results of parallel experiments using 200 μM cocaine in the absence and in
the presence of a single γ-lactone concentration at which the lactone did not
induce motility decrease by itself. Cocaine at a concentration of 200 μM
decreased planarian motility by about 50 % (Figure 14), which is consistent
with previously reported results (Pagán, et al., 2008).
The only compound
capable of antagonizing cocaine effectively
was γ-nonalactone, which, at a concentration of about 50μM, significantly
alleviated the 200μM cocaine-induced motility decrease from about 51% (cocaine
alone) to about 12% (cocaine + γ-nonalactone, )
See Appendix Table 2. Figure 14
demonstrates γ-nonalactone’s effect on cocaine-induced motility decrease as
concentration-dependent and becomes synergistic with cocaine at γ-nonalactone
concentrations higher than 75μM.
Results for γ-Nonalactone
Figure 14: Results for Gamma
Nonalactone expressed at a fraction of the control.
This work has established the γ-lactone
moiety associated to a 5-carbon methyl tail attached to position 4 in the
lactone ring (γ-nonalactone, Figure 15.) to be the minimum structure necessary
to reverse cocaine-induced mobility inhibition in planarians. This is
consistent with previous work which indicated that the lactone ring in this
class of compounds is essential for their cocaine-antagonist effect in this
experimental system (Pagán, et al., 2008).
The results, however, indicate that the γ-lactone moiety is not
sufficient to antagonize cocaine effects because none of the other lactones
that were tested demonstrated any significant alleviation of cocaine-related
symptoms in planarians. We also
determined that the γ-nonalactone effect on cocaine was
concentration-dependent, suggesting that γ-nonalactone and cocaine compete for
a specific binding site in planarians, presumably a protein receptor.
Additional evidence in favor of a common or overlapping binding site for cocaine
and the γ-nonalactone can be deduced by the observation that γ-lactones with
alkyl chains longer than 5 carbons decrease motility by themselves yet they are
inactive antagonists against cocaine.
This
phenomenon is somewhat reminiscent of the cutoff effect observed in some types
of general anesthetic molecules. The cutoff effect is the increase in
anesthetic potency of a homologous series of compounds, for example, n-alkanes
or n-alkanols among others, up to a point where a decrease (or even total loss)
of the anesthetic effect is observed in higher molecular weight compounds (Eckenhoff
et al., 1999). This effect is frequently used to estimate the molecular
dimensions of protein targets (Eckenhoff , et al., 1999; Franks and
Lieb, 1985), but other interpretations, including the interaction of the
anesthetic compounds with membranes, as opposed to proteins, has also been
proposed (Mohr, 2005). It is possible that we are observing a mechanism similar
to the cutoff effect in these γ-lactones/cocaine experiments.
Interestingly, the biggest lactone tested, Dodecalactone,
is very similar to Parthenolide in terms of its molecular weight, yet Dodecalactone
was inactive against cocaine. This indicates that molecular size must not be
the only property that influences parthenolide's (or the γ-lactones)
anti-cocaine properties.
Another consideration that is being
explored is the ratio of optic R to S enantiomers found in the various lactones
as well as in Parthenolide. Preliminary findings suggest Octalactone as well as
Decalactone favor the R configuration while both parthenolide and nonalactone
are either a racemic mixture, have a slight S leaning R to S ratio or favor the
S confirmation (get data and facts.)
Similar
Results in Mammals
Parthenolide has
recently been administered to rats that had been exposed to, “acute,”
injections of cocaine. Parthenolide has been found to block the inhibitory
effect of cocaine upon the dopamine neurological firing rate in the rats. In mammalian systems, cocaine works on the
ventral tegmental area of the dopaminergic network which is associated with
motivation and reward. These more
sophisticated pathways do not exist in planarian systems but it is significant
that Parthenolide seems to inhibit the activity of cocaine using a pathway in a
mammalian subject that is not found in the planarian brain (Schwartz, et al., 2011).
Part Two: Determining
how the Transcription Rate of Dopamine Receptors is Affected by Parthenolide
and Gamma Nonalactone
Introduction
Our lab has recently
had a paper published in which we have documented the alkyl γ -lactone
structure with a four carbon hydrocarbon chain as the least substituted
structure necessary to antagonize the effect cocaine has on the nervous system
of planarian worms (Baker, et al., 2011).
The mechanism of action is not known but cocaine is known to obstruct
the dopamine transporter protein (Mateo, et al., 2004). It is also known to decrease the number of
post-synaptic dopamine receptors in humans that abuse cocaine (Volkow, 1997). As
a result, understanding the changes in transcription in RNA that is translated
into the Dopamine transporter protein and associated membrane proteins may be
illuminating.
Methods
RNA is isolated from planarians
Planarians of a uniform
size are separated into four discrete groups according to their treatment. The
first group was the control that had been exposed to artificially formulated
pond water (APW) and Dimethyl Sulfoxide (DMSO) at 0.1%. Another group has been exposed to cocaine at
a concentration of 200 µM.
A third group will be exposed to a combination of cocaine at 200 µM
and gamma nonalactone at a concentration of 50 µM. The fourth group will be a combination of
cocaine at 200 µM
and Parthenolide at 50 µM. All four groups will be placed in
solution with DMSO at a 0.1% concentration.
The planarians will be
decapitated and their heads will be harvested and homogenized. mRNA will be isolated and the transcription
rate for genes of interest will be evaluated by running each group through a
qrtPCR procedure. The results will be
compared in such a way that any significant differences between the control and
the other variable being tested will be analyzed.
The
procedure is as follows:
RNA
isolation
Approximately ten planarians
will be allocated to each of the four treatments and each group was
pre-incubated in its respective solution for ten minutes after which time, they
were euthanized, decapitated, and placed in 0.5mL Trizol. Care was taken to avoid dilution of Trizol when transferring planarians to the container of
Trizol. After the planarians were in Trizol, they were homogenized using a
Power Gen 125 homogenizer. At this point, the cells have been lysed and
organelles are able to be fractionated.
100µL.
of chloroform was then added in a microfuge tube and the mixture the mixture
was then gently shaken for 15 seconds and was allowed to incubate at room
temperature (approximately 20 degrees, C.) for 5 minutes.
The mixture was then centrifuged at 12,000
rpm/ref. for a total time of ten minutes.
Up until this point,
the rationale for this procedure is as follows: Trizol is used to lyse
membranes and allow the contents of the cell to become available. Trizol aids
in the homogenation process. Chloroform has
an affinity for RNA and helps it go into solution while the Trizol and other
organic material precipitate out of solution.
RNA is isolated with
the top layer and then precipitated out of solution with the addition of
isoproponol.
The Pellet was washed
in cold 75% ETOH and then centrifuged at 12,000 (rpm/ref) for an additional 7
minutes.
The supernatant will be
discarded and the pellet will be allowed to dry for five minutes.
The pellet should be
re-suspended in 50 µl of DEPC water. If the pellet is having trouble going back
into suspension, the solution might need to be gently heated.
After the pellet had
gone into suspension, the RNA should be placed on ice.
The concentration of
RNA was determined using the Nanodrop and calculations will be conducted in
order to ensure that 2µg of RNA will be found at the beginning
of each amplification.
RNA may be frozen at
this time at -80C degrees.
Reverse
Transcription
A reaction for
converting RNA into cDNA is as follows:
Determine the volume of
RNA solution needed to make 2.0µL. of RNA, add 10.0µL
of Master Mix, 3.0µl of oligo (dt) primer, and add enough RNase-free water for
29.0 µL total.
Centrifuge and incubate
at 70C degrees for 5 minutes. After 5 minutes, transfer immediately to ice.
Cool for 2 minutes and then add 1.0µL Superscript III
reverse transcriptase (total volume is 30.0 µL).
Incubate at 42C degrees
for 30 minutes.
Centrifuge and incubate
at 90C degrees for 5 minutes.
Actin-B or 22Sribosomal
subunit will be employed as a positive control.
Thaw Brilliant SYBR
Green qftPCR mastermix and take precautions to protect from light.
Use 0.5mL centrifuge
tubes.
Quantitative
Reverse Transcription Polymerase Chain Reaction
qrtPCR
Set up the following
reaction:
12.5µL
qrtPCR mastermix
1.8 µL
forward primer
2.0 µL
reverse primer
5.7µL
sterile RNase-free water
1.0 µL
cDNA
This should add up to
23.0 µL.
Transfer each reaction
to a 96 well plate and program the QPCR machine
(which will need to be programmed with the appropriate data).
Analysis
of Results
Determining any
potential change in the transcription rate of mRNA for this gene using these
variables will help to provide an understanding of the mechanism of action
being employed by the lactone that was observed to antagonize cocaine in
planarians. A significant change; either
an increase or decrease in transcription may prove illuminating since dopamine
receptors’ pharmacokinetics are challenging to predict (Suhara, et al., 2010).
Genes associated with
the CNS are highly conserved across species. This is beneficial for two reasons; the
primers have a good chance of being similar enough for the cDNA to produce
similar results in other organisms. More significantly, high conservation of
the basic genetic framework lends support for the possibility that
understanding the relatively simple planarian system will eventually lead to an
enhanced understanding of the more complex mammalian system that is exploited
by drugs of addiction (Schwartz, et al., 2011).
Normal controls are
being employed to increase confidence in the results. A negative control,No RT
cDNA has identified contaminated RNA and those tests have been repeated. Positive controls namely No Primers and No
Template were also incorporated in the procedure to elevate the confidence in
this experimental design.
Expected
Outcomes/Alternative Approaches
Expected
outcomes
The expected outcome of
this effort is to quantify the change in the transcription/expression rate of
one of the receptors and/or transporters in the dopaminergic pathway that is
exploited by cocaine. The receptors seem
to be down regulated and, because cocaine blocks the
dopamine transporter (DAT). The synapse
is flooded with excessive dopamine triggering a down regulation of the receptor.
The logical expectation is to observe a lower transcription rate for the
dopamine receptor in planarians exposed to cocaine and a higher transcription
rate for planarians exposed to cocaine and γ-Nonalactone or the
cocaine-Parthenolide combination compared with cocaine alone.
Actual results after
the first round of qrtPCR: primers for the dopamine receptor did not arrive and
the original primer sequence was not available. The β-Actin used as a positive
control displayed multiple dissociations that suggest a lack of specificity for
that particular locus.
New primer sequences
for the β-Actin and the dopamine receptor were found.
Β-Actin primers have
been graciously provided by Dr. Guangwen Chen.
Forward:
ACACCGTACCAATCTATG
Reverse:
GAGAAACTGTAACCTCGT
Dopamine Receptor
primers have been provided by Dr.H. Agata.
Forward:
CGAATTGGCGATCGACTTAAATCTGCAC
Reverse:
TCCTATAATCGGGATTTTGTGAGCTTTCCA
Dopamine 1Receptor
primers (provided by Dr. Agata.)
CGAATTGGCGATCGACTTAAATCTGCAC
TCCTATAATCGGGATTTTGTGAGCTT
Table
1 Primer Sequences to be Used in qrtPCR
Gene
|
Source
|
Forward Primer
|
Reverse Primer
|
Just Exon?
|
β-Actin
|
Dr. Guangqwn Chen
|
ACACCGTACCAATCTATG
|
GAGAAACTGTAACCTCGT
|
NO
|
Dopamine Receptor
|
Dr. Agata
|
TCCTATAATCGGATTTTGTGAGCTTTCCA
|
YES
|
|
Dopamine
Receptor
|
||||
Dopamine
Transporter DAT
|
Jayanthi
|
5′-TAACCGCATTCTATGTGGATTTC-3′, exon 2)
|
5′-GTTGCACAATTGATGAATGATGTG-3′, exon 7)
|
I think
yes
|
Alternative DAT
|
(RB452: 5′-CAAATCTTCAGACGATCCCGACGAA-3′)
|
(RB453: 5′-CTAGGATAATGAAAGTGGAAGACAC-3′)
|
I think yes
|
|
Results
The results
of this observation have been hindered because the genome of D. tigrina seems unstable and the S. mediterranea that the lab has received
have not been viable and have certainly not been able to propagate colonies
sufficient to supply enough tissue to isolate RNA. A survey of peer-reviewed literature reveals
very little information about the normal pattern of a gel of rRNA for D.
tigrina and the gels I have been able to find were not configured in the normal
large and smaller band way that is the expected pattern for eukaryotes.
Discussion
Discussion
will vary depending upon future direction.
As of this writing, a colony of S. mediterranea
has not been secured sufficiently to isolate enough RNA to carry on a qrtPCR as
detailed in Part Two.
Alternative
Approaches
Eventually, RNAi
techniques will be applied in order to determine the role of various components
of the planarian dopaminergic system play in cocaine toxicity and its
alleviation when alkyl lactones were tested.
The immediate
issue that has prevented the genetic analysis to be conducted efficiently is
the questionable stability of the D. tigrigna’s
genome. The double bands of 22s ribosomal gel ladder was not evident, even after the
procedure was observed by Dr. Gestl in order to detect human error. Two separate donations of S. mediterranea were not able to survive
under the care of members of the Pagan Lab.
Eventually, these problems will be resolved and S. mediterranea will replace D. tigrina.
S. mediterranea has a stable genome which opens up the world of microarrays,
Blotting, and RNAi.
Another assay that has
potential is a spectral analysis to determine the molecular structures that may
provide information that will contribute to the general understanding of what
is going on at the molecular level at the receptor site.
No comments:
Post a Comment